|
ATCC
rat adrenal pheochromocytoma pc12 cell lines Rat Adrenal Pheochromocytoma Pc12 Cell Lines, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pc12+crl+1721+rat+neuronal+cell+line/PC-12%3B+Pheochromocytoma%3B+Rat/pm41745405-57-0-6 Average 96 stars, based on 1 article reviews
rat adrenal pheochromocytoma pc12 cell lines - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
ATCC
cell toxicity assay rat adrenal medulla cells Cell Toxicity Assay Rat Adrenal Medulla Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pc12+crl+1721+rat+neuronal+cell+line/PC-12/pmc02911349-92-0-8 Average 98 stars, based on 1 article reviews
cell toxicity assay rat adrenal medulla cells - by Bioz Stars,
2026-09
98/100 stars
|
Buy from Supplier |
|
ATCC
adherent type Adherent Type, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pc12+crl+1721+rat+neuronal+cell+line/PC-12+Adh%3B+Pheochromocytoma%3B+Rat/pmc10196224-65-5-7 Average 94 stars, based on 1 article reviews
adherent type - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
ATCC
site directed mutagenesis cell culture rat pheochromocytoma pc12adh cells ![]() Site Directed Mutagenesis Cell Culture Rat Pheochromocytoma Pc12adh Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pc12+crl+1721+rat+neuronal+cell+line/PC-12+Adh/pmc05572922-448-63-71 Average 95 stars, based on 1 article reviews
site directed mutagenesis cell culture rat pheochromocytoma pc12adh cells - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
ATCC
cell culture rat pheochromocytoma pc12 cell line ![]() Cell Culture Rat Pheochromocytoma Pc12 Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pc12+crl+1721+rat+neuronal+cell+line/Pfizer+Pneumococcal+polysaccharide+powder+Type+1/pmc09178502-52-0-9 Average 95 stars, based on 1 article reviews
cell culture rat pheochromocytoma pc12 cell line - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
ATCC
rat pheochromocytoma pc12 ![]() Rat Pheochromocytoma Pc12, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pc12+crl+1721+rat+neuronal+cell+line/Proteus+mirabilis+Hauser/pmc04827835-63-0-3 Average 94 stars, based on 1 article reviews
rat pheochromocytoma pc12 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
ATCC
rat pheochromocytoma cells pc12 ![]() Rat Pheochromocytoma Cells Pc12, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pc12+crl+1721+rat+neuronal+cell+line/Fetal+Bovine+Serum/pmc02614914-64-0-7 Average 97 stars, based on 1 article reviews
rat pheochromocytoma cells pc12 - by Bioz Stars,
2026-09
97/100 stars
|
Buy from Supplier |
|
ATCC
transplantable rat pheochromocytoma ![]() Transplantable Rat Pheochromocytoma, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pc12+crl+1721+rat+neuronal+cell+line/TIBx%3B+Epithelial+liver%3B+Mouse/pmc02576403-47-7-10 Average 97 stars, based on 1 article reviews
transplantable rat pheochromocytoma - by Bioz Stars,
2026-09
97/100 stars
|
Buy from Supplier |
|
ATCC
pc 12 cells ![]() Pc 12 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pc12+crl+1721+rat+neuronal+cell+line/Tick+Cell+Line%2C+ISE6/pm11302375-232-0-3 Average 95 stars, based on 1 article reviews
pc 12 cells - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
ATCC
lncap clone fgc ![]() Lncap Clone Fgc, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pc12+crl+1721+rat+neuronal+cell+line/LNCaP+clone+FGC/custom%40crl-1740%4030923762 Average 99 stars, based on 1 article reviews
lncap clone fgc - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Becton Dickinson
collagen iv plates ![]() Collagen Iv Plates, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pc12+crl+1721+rat+neuronal+cell+line/collagen+iv+plates/pmc03656097-203-21-25 Average 90 stars, based on 1 article reviews
collagen iv plates - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
ATCC
sh-sy5y ![]() Sh Sy5y, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pc12+crl+1721+rat+neuronal+cell+line/SH-SY5Y/custom%40crl-2266%4018804458 Average 99 stars, based on 1 article reviews
sh-sy5y - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
Image Search Results
Journal: The Journal of Biological Chemistry
Article Title: Phosphorylation at serine 31 targets tyrosine hydroxylase to vesicles for transport along microtubules
doi: 10.1074/jbc.M116.762344
Figure Lengend Snippet: Distribution of TH phosphorylated forms. A–C, HEK293 cells were transfected with the WT or the phospho-null V5-TH1-S19A, V5-TH1-S31A, and V5-TH1-S40A or the phospho-mimicking V5-TH1-S19E, V5-TH1-S31E, and V5-TH1-S40E constructs. Phosphorylation at Ser-19, Ser-31, or Ser-40 was detected by Western blotting, loading equal amounts of total protein. Total TH (THt), V5 (transfection control), and GAPDH (loading control) detection was also carried out. D, immunofluorescence (top panels) of THSer(P)-31 in PC12* cells treated or not with R/S to inhibit Ser-31 phosphorylation and corresponding Western blot analysis (bottom panel), where total TH and GAPDH were also detected as controls. Arrows, perinuclear signal. E, immunofluorescence of total TH, THSer(P)-19, and THSer(P)-40 in PC12* cells treated or not with R/S. F, cellular distribution of THSer(P)-31 in PC12Adh. Arrows, perinuclear signal. G, cellular distribution of THSer(P)-31 in human pluripotent induced dopaminergic neurons (iCell DopaNeurons). Arrows, perinuclear signal. H, THSer(P)-31 distribution in PC12* stimulated with 50 ng/ml 2.5S NGF for 48 h. Insets, enlarged numbered areas. In all images, 10-μm scale bars are shown, and all nuclei are stained with DAPI (blue). I, whole-lysate Western blot of PC12* and PC12Adh cell lines stimulated or not with NGF and detection of dopamine-related marker proteins such as DOPA β-hydroxylase (DBH), chromogranin A (ChrA), total TH, THSer(P)-31, and vesicular monoamine transporter 2 (VMAT2). Equal amounts of protein were loaded as shown in the total protein loading represented in the right panel.
Article Snippet: Soluble enhanced green fluorescent protein (GFP) was purchased from Clontech. pHM6-α-synuclein-A53T mutant was a gift from David Rubinsztein (Addgene plasmids 40824 and 40825) and described previously ( 74 ). table ft1 table-wrap mode="anchored" t5 caption a7 Primer Forward strand sequence 5′–3′ TH1-S19A CTTCCGCAGGGCCGTGGCGGAGCTGGACGCCAAGC TH1-S19E CGCAGGGCCGTGGAGGAGCTGGACGCCAAG TH1-S31A GGCCATCATGGCCCCGCGGTTC TH1-S31E CAGAGGCCATCATGGAGCCGCGGTTCATTG TH1-S40A CATTGGGCGCAGGCAGGCGCTCATCGAGGACGCCCG TH1-S40E GGGCGCAGGCAGGAACTCATCGAGGAC Open in a separate window Sequence of primers used for
Techniques: Transfection, Construct, Phospho-proteomics, Western Blot, Control, Immunofluorescence, Staining, Marker
Journal: The Journal of Biological Chemistry
Article Title: Phosphorylation at serine 31 targets tyrosine hydroxylase to vesicles for transport along microtubules
doi: 10.1074/jbc.M116.762344
Figure Lengend Snippet: Endogenous THSer(P)-31 co-distribution with Golgi complex and vesicle markers. A, co-detection of THSer(P)-31 (green) with the Golgi marker GM130 (red) in PC12Adh (maximum projection of the confocal stack is shown) and 3D rendering of each signal and the corresponding co-localization channel in yellow. Arrows, perinuclear signal. B, co-detection of THSer(P)-31 (green) with the Golgi marker GM130 (red) in DopaNeurons treated or not with R/S. Arrows, perinuclear signal. C, GC disruption in PC12* by 30 min 5 μg/ml brefeldin A (BFA) incubation and subsequent reassembly by drug washout. Untreated samples are presented as control. D, THSer(P)-31 (green) co-detection with synaptotagmin I (sytI; red) in PC12Adh cells without (top) and with (bottom) NGF treatment. E, THSer(P)-31 co-detection of sytI (top) and VMAT2 (vesicular monoamine transporter 2; bottom) in iCell DopaNeurons. For D and E, pixel height in the surface plot represents the pixel intensity in the confocal plane. In all images, nuclei are stained with DAPI, and 10-μm scale bars are shown.
Article Snippet: Soluble enhanced green fluorescent protein (GFP) was purchased from Clontech. pHM6-α-synuclein-A53T mutant was a gift from David Rubinsztein (Addgene plasmids 40824 and 40825) and described previously ( 74 ). table ft1 table-wrap mode="anchored" t5 caption a7 Primer Forward strand sequence 5′–3′ TH1-S19A CTTCCGCAGGGCCGTGGCGGAGCTGGACGCCAAGC TH1-S19E CGCAGGGCCGTGGAGGAGCTGGACGCCAAG TH1-S31A GGCCATCATGGCCCCGCGGTTC TH1-S31E CAGAGGCCATCATGGAGCCGCGGTTCATTG TH1-S40A CATTGGGCGCAGGCAGGCGCTCATCGAGGACGCCCG TH1-S40E GGGCGCAGGCAGGAACTCATCGAGGAC Open in a separate window Sequence of primers used for
Techniques: Marker, Disruption, Incubation, Control, Staining
Journal: Journal of neurochemistry
Article Title: Resveratrol prevents cadmium activation of Erk1/2 and JNK pathways from neuronal cell death via protein phosphatases 2A and 5
doi: 10.1111/jnc.13233
Figure Lengend Snippet: Low concentrations of resveratrol do not display cytotoxic effects on PC12 cells. PC12 cells were treated with resveratrol (Res, 0–400 μM) for 24 h. (a) Cell viability was evaluated using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, and (b) lactate dehydrogenase (LDH) activity in culture medium was determined by LDH release assay, showing that 5–100 μM Res had no cytotoxic effects on PC12 cells in culture. Results are presented as mean ± SE, n = 5. Using one-way anova, *p < 0.05, **p < 0.01, difference with control group.
Article Snippet:
Techniques: MTT Assay, Activity Assay, Lactate Dehydrogenase Assay, Control
Journal: Journal of neurochemistry
Article Title: Resveratrol prevents cadmium activation of Erk1/2 and JNK pathways from neuronal cell death via protein phosphatases 2A and 5
doi: 10.1111/jnc.13233
Figure Lengend Snippet: Resveratrol prevents Cd from reducing cell viability and altering cell morphology in neuronal cells. PC12 cells and/or primary neurons were pre-treated with resveratrol (Res, 0–100 μM for 1 h, and then exposed to Cd (10 and 20 μM for 24 h. (a) Live cells were detected by counting viable cells using trypan blue exclusion, showing that Res rescued PC12 cells from Cd-induced reduction of cell viability concentration-dependently. (b) Morphology of PC12 cells and primary neurons was visualized under a Nikon Eclipse TE2000-U inverted phase-contrast microscope (200×) equipped with a digital camera. Scale bar: 100 μm. Results are presented as mean ± SE, n = 5. Using one-way anova, ap < 0.05, difference with control group; bp < 0.05, difference with 10 μM Cd group; cp < 0.05, difference with 20 μM Cd group.
Article Snippet:
Techniques: Concentration Assay, Microscopy, Control
Journal: Journal of neurochemistry
Article Title: Resveratrol prevents cadmium activation of Erk1/2 and JNK pathways from neuronal cell death via protein phosphatases 2A and 5
doi: 10.1111/jnc.13233
Figure Lengend Snippet: Expression of dominant negative c-Jun or dominant negative MKK1 potentiates resveratrol inhibition of Cd-induced neuronal cell death. PC12 cells, infected with Ad-dn-c-Jun, Ad-MKK1-K97M and Ad-GFP (as control), respectively, were pre-treated with/without resveratrol (Res, 100 μM for 1 h, and then exposed to Cd (10 μM for 4 h (for western blotting) or 24 h (for live cell analysis, 4′,6-diamidino-2-phenylindole, DAPI staining). (a) Indicated cell lysates were subjected to western blot analysis using indicated antibodies. The blots were probed for β-tubulin as a loading control. Similar results were observed in at least three independent experiments. (b) Live cells were detected by counting viable cells using trypan blue exclusion. (c) The percentages of apoptotic cells with fragmented nuclei were quantified by DAPI staining. Results are presented as mean ± SE, n = 5. Using one-way anova or Student’s t-test, ap < 0.05, difference with control group; bp < 0.05, difference with 10 μM Cd group; cp < 0.05, Ad-dn-c-Jun group or Ad-MKK1-K97M group versus Ad-GFP group.
Article Snippet:
Techniques: Expressing, Dominant Negative Mutation, Inhibition, Infection, Control, Western Blot, Cell Analysis, Staining
Journal: Journal of neurochemistry
Article Title: Resveratrol prevents cadmium activation of Erk1/2 and JNK pathways from neuronal cell death via protein phosphatases 2A and 5
doi: 10.1111/jnc.13233
Figure Lengend Snippet: Resveratrol prevents Cd-induced apoptosis of neuronal cells. PC12 cells and primary neurons were pre-treated with/without resveratrol (Res, 100 μM for 1 h, and then exposed to Cd (10 and 20 μM for 4 h (for western blotting) or 24 h (for 4′ ,6-diamidino-2-phenylindole, DAPI and TUNEL staining). (a) Apoptosis in PC12 cells was evaluated by nuclear fragmentation and condensation (arrows) using DAPI staining (upper panel) and concurrently by in situ detection of fragmented DNA (in green) using TUNEL staining (lower panel). Scale bar: 20 μm. (b and c) The percentages of cells with fragmented nuclei and the fluorescence staining of TUNEL-positive cells were quantified, showing that resveratrol markedly attenuated Cd-induced apoptosis in PC12 cells and primary neurons. (d) Indicated cell lysates were subjected to western blot analysis using antibodies to cleaved-caspase-3. The blots were probed for β-tubulin as a loading control. Similar results were observed in at least three independent experiments. Results are presented as mean ± SE, n = 3–5. Using one-way anova, ap < 0.05, difference with control group; bp < 0.05, difference with 10 μM Cd group; cp < 0.05, difference with 20 μM Cd group.
Article Snippet:
Techniques: Western Blot, TUNEL Assay, Staining, In Situ, Fluorescence, Control
Journal: Journal of neurochemistry
Article Title: Resveratrol prevents cadmium activation of Erk1/2 and JNK pathways from neuronal cell death via protein phosphatases 2A and 5
doi: 10.1111/jnc.13233
Figure Lengend Snippet: Resveratrol inhibits Cd-induced neuronal cell death by blocking JNK and extracellular signal-regulated kinases 1/2 (Erk1/2) pathways. PC12 cells and primary neurons were pre-treated with resveratrol (Res, 0–100 μM for 1 h, or with/without Res (100 μM in the presence or absence of SP600125 (20 μM or U0126 (5 μM for 1 h, and then exposed to Cd (10 and/or 20 μM for 4 h (for western blotting) or 24 h (for 4′,6-diamidino-2-phenylindole, DAPI staining). (a–c) Indicated cell lysates were subjected to western blot analysis using indicated antibodies, showing that resveratrol partially inhibited Cd-induced phosphorylation of JNK/c-Jun, Erk1/2 and p38 in the cells (a and b), and inhibitors of Erk1/2 (U0126) and JNK (SP600125) strengthened the inhibitory activity of resveratrol (c). The blots were probed for β-tubulin as a loading control. Similar results were observed in at least three independent experiments (a and c), and blots for p-JNK, p-c-Jun, p-Erk1/2, p-p38 were semi-quantified (b). (d) The percentages of apoptotic cells with fragmented nuclei were quantified by DAPI staining, showing that pharmacological inhibition of JNK and Erk1/2 enhanced resveratrol prevention of Cd-induced neuronal cell death. Results are presented as mean ± SE, n = 5. Using one-way or two-way anova, ap < 0.05, difference with control group; bp < 0.05, difference with 10 μM Cd group; cp < 0.05, difference with 20 μM Cd group; dp < 0.05, difference with Cd/SP600125 group, Cd/U0126 group or Cd/Res group.
Article Snippet:
Techniques: Blocking Assay, Western Blot, Staining, Phospho-proteomics, Activity Assay, Control, Inhibition
Journal: Journal of neurochemistry
Article Title: Resveratrol prevents cadmium activation of Erk1/2 and JNK pathways from neuronal cell death via protein phosphatases 2A and 5
doi: 10.1111/jnc.13233
Figure Lengend Snippet: Over-expression of PP2A and PP5 strengthens resveratrol inhibition of Cd-induced activation of extracellular signal-regulated kinases 1/2 (Erk1/2), JNK and/or p38, as well as cell death. PC12 cells, infected with Ad-PP2A, Ad-PP5, or Ad-GFP (as control), were pre-treated with/without resveratrol (Res, 100 μM for 1 h, and then exposed to Cd (10 μM for 4 h (for western blotting) or 24 h (for live cell analysis, 4′,6-diamidino-2-phenylindole, DAPI staining). (a and e) Cell lysates were subjected to western blot analysis using indicated antibodies. The blots were probed for β-tubulin as a loading control. Similar results were observed in at least three independent experiments (a and e), and blots for p-JNK, p-c-Jun, p-Erk1/2, p-p38, cleaved-caspase-3 were semi-quantified (b and f). (c and g) Live cells were detected by counting viable cells using trypan blue exclusion. (d and h) The percentages of apoptotic cells with fragmented nuclei were quantified by DAPI staining. Results are presented as mean ± SE, n = 5. Using one-way anova or Student’s t-test, ap < 0.05, difference with control group; bp < 0.05, difference with 10 μM Cd group; cp < 0.05, Ad-PP2A group or Ad-PP5 group versus Ad-GFP group.
Article Snippet:
Techniques: Over Expression, Inhibition, Activation Assay, Infection, Control, Western Blot, Cell Analysis, Staining
Journal: Journal of neurochemistry
Article Title: Resveratrol prevents cadmium activation of Erk1/2 and JNK pathways from neuronal cell death via protein phosphatases 2A and 5
doi: 10.1111/jnc.13233
Figure Lengend Snippet: Resveratrol prevents Cd from reducing PP2A and PP5 activity in neuronal cells. PC12 cells and primary neurons were pre-treated with/without resveratrol (Res, 100 μM for 1 h, and then exposed to Cd (10 and 20 μM for 4 h, followed by western blot analysis using indicated antibodies, showing that resveratrol significantly inhibited Cd-induced reduction of PP2A and PP5 activity in the cells. The blots were probed for β-tubulin as a loading control. Similar results were observed in at least three independent experiments.
Article Snippet:
Techniques: Activity Assay, Western Blot, Control
Journal: PLoS ONE
Article Title: Rett Syndrome Mutant Neural Cells Lacks MeCP2 Immunoreactive Bands
doi: 10.1371/journal.pone.0153262
Figure Lengend Snippet: ( A ) Diagram of the hMeCP2e1-RFP protein illustrating the position of the MeCP2 and RFP antibodies. ( B-D ) Western-blot analysis of hMeCP2e1-RFP + HEK293 cell line with antibodies against the N- and C-terminal region of MeCP2. ( E ) RFP immunoreactive bands in transfected HEK293 cell line. ( F-H) Western-blot analysis of hMeCP2e1-RFP + PC12 cell line with antibodies against the N- and C-terminal region of MeCP2. (I) RFP immunoreactive bands in transfected PC12 cell line. (J-L) Western-blot analysis of hMeCP2e1-RFP + N2A cell line with antibodies against the N- and C-terminal region of MeCP2. ( M ) RFP immunoreactive bands in transfected N2A cell line. ( N-P ) Western-blot analysis of hMeCP2e1-RFP + SHSY5Y cell line with antibodies against the N- and C-terminal region of MeCP2. ( Q ) RFP immunoreactive bands in transfected SHSY5Y cell line. Protein size markers (in kilodaltons) are indicated on the right of each panel.
Article Snippet:
Techniques: Western Blot, Transfection